bceB [2019-12-28 16:19:22]

primary bacitracin resistance determinant, ABC transporter (permease) for the export of bacitracin, plectasin, mersacidin and actagardine, sensory component of the Bce regulatory & detoxification system

Locus: BSU_30370

Isoelectric point: 9.79

Molecular weight: 72.01 kDa

Protein length: 646 aa

Gene length: 1941 bp

Function: export of toxic peptides

Product: bacitracin ABC transporter (permease)

Essential: no

Synonyms: ytsD

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → ABC transporters → Exporters → Export of peptides
• Lifestyles → Coping with stress → Resistance against toxins/ antibiotics
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,109,397 → 3,111,337

Phenotypes of a mutant

• 85-fold increased sensitivity to bacitracin PubMed

The protein

Catalyzed reaction/ biological activity

• binds bacitracin, K_D: 60 nM PubMed
• inhibits BceS autophosphorylation activity in the absence of bacitracin PubMed

Protein family

• ABC-4 integral membrane protein family (according to UniProt)

Effectors of protein activity

• the activity of the BceA-BceB ABC transporter is inhibited by heptaprenyl pyrophosphate which accumulates in a ytpB mutant PubMed

Localization

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• Genes: bceA-bceB
  Description: PubMed

  Regulatory mechanism

  • BceR: activation, PubMed, in BceR regulon

  Regulation

  • induced in the presence of bacitracin, plectasin, mersacidin and actagardine, already at very low levels of bacitracin (BceR) PubMed

Biological materials

Mutant

• MGNA-A168 (ytsD::erm), available at the NBRP B. subtilis, Japan
• BKE30370 (ΔbceB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GATTAATGTTCATGCTGCAC, downstream forward: _UP4_TGAAACAGAAAAAGCTCCAG
• BKK30370 (ΔbceB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GATTAATGTTCATGCTGCAC, downstream forward: _UP4_TGAAACAGAAAAAGCTCCAG

References

Reviews

Loading

Original publications

Loading